biologie

Logiciels (logiciels libres en majorité) ou ressources (liées aux logiciels) utiles aux chercheurs et enseignants en biologie
Fiche dév Ens Sup - Recherche
  • Création ou MAJ importante : 27/07/10
  • Correction mineure : 05/10/10
Mots-clés

EDNA : environnement pour réaliser des programmes d'analyses de données en ligne

Ce logiciel a été développé (ou est en cours de développement) dans la communauté de l'Enseignement Supérieur et de la Recherche. Son état peut être variable (cf champs ci-dessous) donc sans garantie de bon fonctionnement.
  • Site web
  • Système : UNIX-like, Windows, MacOS X
  • Version actuelle : 1.0 (prototype MXv1) - revision SVN 1794
  • Licence(s) : GPL - Le noyau de EDNA est LGPL, les applications et autres plugins applicatifs sont GPL.
  • Etat : diffusé, stable, utilisé en interne, en développement
  • Support : maintenu, développement en cours
  • Concepteur(s) : Executive Comitee Chair : Andrew Leslie (MRC-LMB) ; Project Manager: Olof Svensson (ESRF) ; Project Coordinator : Alun Ashton (Diamond). Au total plus de 40 développeurs dans près de 15 instituts de par le monde.
  • Contact concepteur(s) : edna@esrf.fr
  • Laboratoire(s), service(s)... : EMBL, ESRF, SOLEIL Synchrotron, DLS, MRC-LMB, CCP4, Bessy (HZB), Max Lab. NSLS, SLS-PSI, Univ Sidney, Univ York, Global Phasing

 

Fonctionnalités générales du logiciel

EDNA est un framework, un environnement permettant de réaliser des logiciels d'analyse de données en ligne, hautement parallèlisé et met sous contrôle des logiciels scientifiques en les enchaînant à la manière d'un pipe Unix, mais avec un contrôle individualisé de chacun des programmes sous-jacent. En enchaînant les différents programmes ont peut générer des chemins de traitement (workflow) qui sont réalisés en parallèle (multi-thread asynchrone) et obtenir des temps de traitement très courts, les résultats étant obtenus au cours de l'expérience et non pas en post-traitement.

EDNA est écrit en Python pur pour le noyau (kernel) mais certains plugins nécessitent des bibliothèques annexes comme numpy, scipy, PIL, h5py, ... et exploite très bien les capacités multi-core des machines modernes.

EDNA est basé sur 4 piliers :

  • Modularité : chaque plugin est soit un wrapper pour un executable, soit un control plugin pour un ou plusieurs exec plugin(s). Le coté multithread est géré au niveau du noyau, le programmeur de plugin n'a pas à s'en préoccuper en règle génerale.
  • Gestion de projet (visioconf, workshops, ...) : EDNA dispose d'un comité de pilotage pour coordonner ses développements.
  • Modèles de données (datamodels) décrits en UML --> exporté en XSD --> data-binding python pour assurer une sérialisation des données et pouvoir debugger en cas de problème.
  • Environnement de test: EDNA propose un environnement de test poussé, cela permet un déploiement plus rapide et plus sur et assure la non régression de la globalitê du projet.

Les développeurs de EDNA (ESRF, Diamond, ...) organisent régulièrement des "code-camp" de 1 ou 2 jours pour prendre en main la programmation de nouveaux plugins et enrichir la centaine de plugins déjà écrits et documentés.

Contexte d’utilisation du logiciel

Initialement EDNA a été développé pour la communauté de cristallographie des protéines (automatisation de la réduction des données) mais il est aujourd'hui utilisé pour d'autres domaines comme l'imagerie X (ESRF), l'archivage des données (Diamond, UK), les affinements de structures cristallines, ...

L'idée de EDNA est d'offrir un parallélisme de fils (thread) pour des tâches qui durent entre 0.1s et 10s; mais avec beaucoup de tâches, là ou les gestionnaires de queue/batch type PBS sont assez peu performants (initialisation de chaque processus). Il est néanmoins possible d'utiliser EDNA avec un gestionnaire de batch type SGE (Diamond, UK), Condor (à l'ESRF) ou PBS...

Publications liées au logiciel

EDNA: a framework for plugin-based applications applied to X-ray experiment online data analysis
M.-F. Incardona, G. P. Bourenkov, K. Levik, R. A. Pieritz, A. N. Popov and O. Svensson
J. Synchrotron Rad. (2009). 16, 872-879 [ doi:10.1107/S0909049509036681 ]

Abstract: EDNA is a framework for developing plugin-based applications especially for online data analysis in the X-ray experiments field. This article describes the features provided by the EDNA framework to ease the development of extensible scientific applications. This framework includes a plugins class hierarchy, configuration and application facilities, a mechanism to generate data classes and a testing framework. These utilities allow rapid development and integration in which robustness and quality play a fundamental role. A first prototype, designed for macromolecular crystallography experiments and tested at several synchrotrons, is presented.

Fiche dév Ens Sup - Recherche
  • Création ou MAJ importante : 27/07/10
  • Correction mineure : 31/08/10

HECTAR : localisation subcellulaire, heterokont, machine à vecteur support, metaclassifier, motif, annotation

Ce logiciel a été développé (ou est en cours de développement) dans la communauté de l'Enseignement Supérieur et de la Recherche. Son état peut être variable (cf champs ci-dessous) donc sans garantie de bon fonctionnement.

 

Fonctionnalités générales du logiciel

HECTAR est une méthode de prédiction de localisation subcellulaire. Elle est la première méthode qui prend en compte l'adressage complexe pour le groupe eucaryotique des hétérokontes qui ont développé un système d'adressage complexe pour le transfert des protéines aux plastes.

HECTAR a une architecture hiérarchique, constituée de plusieurs modules de prédiction. Chaque module appelle plusieurs méthodes dédiées à la prédiction d'un signal d'adressage N-terminal. Leurs prédictions sont combinées par une approche de méthode d'ensemble (metaclassifier) en utilisant des machines à vecteur support. La structure modulaire de HECTAR nous a permis d'établir deux variantes de HECTAR, HECTARsec et HECTARmetfun : elles permettent d'appliquer HECTAR pour l'annotation des protéines d'autres groupes des eucaryotes.

Contexte d’utilisation du logiciel

Chez les eucaryotes, la plupart des protéines qui fonctionnent dans des organelles sont codées par le noyau cellulaire. Ces protéines sont transférées aux organelles par de nombreux signaux d'adressage. Les plastes, acquis par endosymbiose secondaire, possèdent des structures très complexes avec plus de deux membranes. L'adressage des protéines aux plastes des hétérokontes est permis par des signaux bi-peptides et un motif conservé autour du site du clivage du premier signal d'adressage. Ces deux signaux posent des problèmes aux méthodes de prédiction de la localisation subcellulaire.

Nous avons développé la méthode HECTAR qui permet la prédiction des cinq catégories des signaux d'adressage. Pour prendre en considération l'adressage complexe au plaste des hétérokontes, une approche hiérarchique a été conçue. Pour la prédiction de chaque peptide un module de décision a été constitué. Plusieurs méthodes de prédiction dédiées à la détection d'un signal d'adressage spécifique sont combinées par une machine à vecteur support. Pour le module qui est dédié à prédire le peptide d'adressage aux plastes nous avons incorporé également un scoring pour la présence d'un motif très conservé (motif ASAFAP). Ce motif est essentiel pour un adressage correct aux plastes des hétérokontes.

HECTAR permet, avec une grande performance, la détection de protéines importées aux plastes des hétérokontes.

De plus, il existe deux variantes de HECTAR :

  • HECTARsec permet de prédire la présence des peptides signaux et des ancres signales pour toutes les protéines eucaryotiques.
  • La deuxième variante, HECTARmetfun, est dédiée à prédire la présence d'un des quatre types de signal d'adressage N-terminal (peptide signal, ancre signal, mitochondrie, pas de signal d'adressage N-terminal) pour les protéines des champignons et les métazoaires.
Publications liées au logiciel

HECTAR: a method to predict subcellular targeting in heterokonts.
BMC Bioinformatics. 2008 Sep 23;9:393.
Gschloessl B, Guermeur Y, Cock JM.

Development of a method which predicts N-Terminal target peptides and study of protein sorting in eukaryote genomes. Gschloessl B., Thèse, 2008, Université Pierre et Marie Curie, Station biologique de Roscoff.

Fiche dév Ens Sup - Recherche
  • Création ou MAJ importante : 21/07/10
  • Correction mineure : 07/10/11
Mots-clés

VLE : Virtual Laboratory Environment - plate-forme de multi-modélisation et de simulation

Ce logiciel a été développé (ou est en cours de développement) dans la communauté de l'Enseignement Supérieur et de la Recherche. Son état peut être variable (cf champs ci-dessous) donc sans garantie de bon fonctionnement.
  • Site web
  • Système : UNIX-like, Windows, MacOS X
  • Version actuelle : 1.0.0 - 15 septembre 2011
  • Licence(s) : GPL
  • Etat : validé (au sens PLUME), diffusé, stable, en développement
  • Support : maintenu, développement en cours
  • Concepteur(s) : Gauthier Quesnel Eric Ramat Guillaume Ansel Patrick Chabrier Raphael Duboz David Duvivier Cyril Marcq Daniel Salomé Ronan Trépos Aurélien Ansel Philippe Blangi Romain Hennuyer David Versmisse Geoffroy Weisenhorn
  • Contact concepteur(s) : quesnel@users.sourceforge.net
  • Laboratoire(s), service(s)... : LIL, UBIA

 

Une fiche logiciel décrit plus en détail ce développement, consultez la pour plus d’informations : VLE
Fonctionnalités générales du logiciel

VLE est une plate-forme de modélisation et de simulation de systèmes dynamiques basée sur le formalisme à événement discret DEVS (de l'anglais Discrete Event System Specification). L'environnement VLE propose un ensemble de bibliothèques, les VFL (VLE Foundation Libraries), sur lesquelles reposent un certain nombre de programmes avec un simulateur, une interface graphique de modélisation et de développement de modèles et des outils annexes pour analyser et visualiser les sorties des simulations, et un service-web. Les VFL sont suffisamment bien conçues pour permettre la construction de nouveaux simulateurs, modèles ou de nouveaux programmes de modélisation et d'analyse.

Contexte d’utilisation du logiciel

L'objectif de VLE est de permettre au modélisateur de systèmes dynamiques de réaliser le cycle de modélisation et de simulation. Le modélisateur construit ainsi un laboratoire virtuel pour réaliser des expériences in silico. La plate-forme est majoritairement utilisé dans un contexte agronomique avec les modèles issus de l'INRA, mais également des modèles épidémiologiques, des modèles d'agents sociaux. Les modèles peuvent alors être exploités via les outils comme R, python, ou via des interfaces web.

Publications liées au logiciel

G. Quesnel, R. Duboz and É. Ramat, The Virtual Laboratory Environment - An Operational Framework for Multi-Modelling, Simulation and Analysis of Complex Systems, Simulation Modelling Practice and Theory, (17), 641-653, April 2009.

Quesnel G., Duboz R., Ramat E., and Traoré M.K.. VLE: A Multimodeling and Simulation Environment. Proceedings of the Summer Simulation Multiconference (SummerSim’07), San Diego, California, USA, July 15-18, 2007, pp. 367-374.

G. Quesnel, R. Duboz, D. Versmisse et É. Ramat, DEVS Coupling of Spatial and Ordinary Differential Equations: VLE framework, proceedings of the Open International Conference on Modeling and Simulation - OICMS 2005, Clermont-Ferrand, France, 281-294.

G. Quesnel, D. Versmisse et E. Ramat. Coupling of physical models and socials models: multi-modeling and simulation with VLE, dans Joint Conference on Multi-Agent Modeling for Environmental Management, CABM-HEMA-SMAGET 05, 21-25 mars Bourg Saint Maurice, France.

G. Quesnel, R. Duboz and É. Ramat, DEVS wrapping: A study case, In proceedings of Conceptual Modeling and Simulation CMS 2004 conference, 28-30 octobre 2004, Genoa, Italy, pp 374-382.

G. Quesnel, R. Duboz et E. Ramat, VLE Environnement de modélisation et de simulation de systèmes hétérogènes : Applications aux systèmes multi-agents, Actes des douzièmes Journées Francophones sur les Systèmes Multi-Agents (JFSMA) - Systèmes multi-agents défis scientifiques et nouveaux usages. Olivier Boissier et Zahia Guessoum eds. Paris, 23-26 novembre 2004.

Fiche logiciel à valider
  • Création ou MAJ importante : 16/07/10
  • Correction mineure : 23/08/13
  • Rédacteur de la fiche : Samuel Garcia - Un des développeurs - Neuroscience Sensorielles Conportement Cognition (CNRS)
  • Contributions importantes : Nicolas Fourcaud-Trocmé
    Stéphane Gaëtan Roux
  • Responsable thématique : Christelle Dantec (CRBM)
Mots-clés
Fiche en recherche de relecteurs
Cette fiche est en recherche de relecteurs. Si vous êtes intéressé(e)s, contactez-nous !

OpenElectrophy : analyse de données électrophysiologiques intra ou extra cellulaire

Ce logiciel est en cours d'évaluation par la communauté PLUME. Si vous utilisez ce logiciel en production dans notre communauté, merci de déposer un commentaire.
Description
Fonctionnalités générales

OpenElectrophy est outil libre écrit en python destiné à l'analyse de données électrophysiologiques intra et/ou extra cellulaire. Situé entre un "framework", un "database management" et une "toolbox", il propose à la fois une interface graphique intuitive pour explorer en grande quantité et une base solide pour des analyses sous forme de script. OpenElectrophy propose notamment une implémentation de plusieurs méthodes de spike sorting ainsi qu'une approche nouvelle pour l'étude des oscillations basée sur la détection de lignes de crête sur un scalogram de Morlet.

Interopérabilité

Capable d'importer la majorité des formats d'acquisition en electrophysiologie.

Limitations, difficultés, fonctionnalités importantes non couvertes

Ce n'est pas juste un logiciel click n play. C'est aussi une toolbox python sur laquelle l'utilisateur devra s'appuyer pour écrire de nouvelles analyses.

Environnement du logiciel
Plates-formes

Linux/Windows

Environnement de développement
Type de structure associée au développement

Laboratoire NSCC (Laboratoire de Neurosciences Sensorielles, Comportement, Cognition), Lyon.
Les auteurs sont Samuel Garcia et Nicolas Fourcaud (NSCC) avec une contribution de Stéphane Gaëtan Roux (Ecole Normale Supérieure de Lyon).

Environnement utilisateur
Documentation utilisateur

Format fasta : représentation de séquences nucléiques ou protéiques (biologie)

Fiche ressource Article, événement, site web...
  • Création ou MAJ importante : 09/07/10
  • Correction mineure : 09/10/13
Mots-clés

Format fasta : représentation de séquences nucléiques ou protéiques (biologie)

Version : pas de version

Extension : .fa, .fasta, .fsa

Type de document : Fichier texte tabulé

Document de standardisation :
Page descriptive sur le site de NCBI
Page descriptive sur le site de HUPO
Page descriptive sur le site de Wikipedia

Description courte :
Format qui permet de représenter un ou plusieurs séquences (nucléiques ou protéiques). Une ligne qui commence par le symbol '>' caractérise le début d'une nouvelle séquence. Le symbol '>' est suivi d'un identifiant de séquence et de commentaires éventuels. Les lignes suivantes constituent la séquence (jusqu'à ce qu'une nouvelle ligne commence par '>' ou la fin de fichier). Exemple :

>FBtr0302953 type=mRNA; loc=2R; name=CG42703-RA;  
TAACCCATAATGTCGAATATACTTGCTGCCAAACTCGACTGCCAATGCGC
CGGAAAAAACAGTCCCATGGATTCGGTGATAGTGCCGATTACCCAGGAAC

Avantages :

  • Est un des standards les plus utilisés en bioinformatique.
  • La plupart des logiciels reconnaissent ce format
  • Ce format peut contenir plus ou moins d'informations (en les ajoutant sur la ligne commencant par '>').

Inconvénients :
Format minimaliste (mais c'est également sa force!)

Logiciels de traitement les plus connus :

Format connexe :

Fiche dév Ens Sup - Recherche
  • Création ou MAJ importante : 29/06/10
  • Correction mineure : 29/06/10
Mots-clés

EZ-Rhizo : analyse de l'architecture racinaire de plantes en boite de Pétri

Ce logiciel a été développé (ou est en cours de développement) dans la communauté de l'Enseignement Supérieur et de la Recherche. Son état peut être variable (cf champs ci-dessous) donc sans garantie de bon fonctionnement.
  • Site web
  • Système : Windows
  • Version actuelle : 1.1 - Novembre 2008
  • Licence(s) : Domaine public
  • Etat : diffusé, stable
  • Support : maintenu, développement en cours
  • Concepteur(s) : Patrick Armengaud, Kevin Zambaux, Adrian Hills, Anna Amtmann
  • Contact concepteur(s) : ez-rhizo@psrg.org.uk; patrick.armengaud@versailles.inra.fr
  • Laboratoire(s), service(s)... : ESIEE, Plant Science Group, FBLS (Glasgow University)

 

Fonctionnalités générales du logiciel

EZ-Rhizo permet une acquisition précise et rapide des paramètres morphologiques des racines à partir d'une boite de Pétri numérisée. Le programme mesure une dizaine de paramètres primaires (la longueur et l'angle de la racine primaire ; le nombre, la longueur, l'angle et la position (par rapport à la racine principale) des racines latérales (racines de deuxième ordre) ; le nombre, la longueur, l'angle et la position des racines de troisième ordre (par rapport à la racine de deuxième ordre) etc. Les données collectées sont organisées dans une base de données (mySQL) associée au logiciel et sont interrogeables soit par une fenêtre de requête pour l'export et la manipulation sous Excel soit directement par une interface de type R.

EZ-Rhizo n'est disponible qu'en anglais et fonctionne uniquement sous Windows.

Attention : EZ-Rhizo ne gère pas les racines supperposées ou celles qui se croisent. Une étape d'édition manuelle est incluse dans le protocole d'analyse pour corriger les imperfections des images. La numérisation d'une boite de Petri 12x12 cm doit etre réalisée au format .bmp à une résolution de 200 dpi.

Contexte d’utilisation du logiciel

EZ-Rhizo est utilisé pour mesurer les adaptations de l'architecture racinaire de plantes d'Arabidopsis thaliana cultivées en boite de Petri 12x12 cm. D'autres espèces végétales peuvent aussi etre mesurées à partir d'images du système racinaire.

Publications liées au logiciel

Armengaud P, Zambaux K, Hills A, Sulpice R, Pattison RJ, Blatt MR and Amtmann A (2008) EZ-Rhizo: Integrated Software for Fast and Accurate Measurement of Root System Architecture. Plant Journal 57(5): 945-956

Armengaud P (2009). EZ-Rhizo software: the gateway to root architecture analysis. Plant Signalling and Behaviour 4(2): 139-141

Fiche dév Ens Sup - Recherche
  • Création ou MAJ importante : 11/05/10
  • Correction mineure : 03/05/12
Mots-clés

BioMAJ : mise à jour et transformation automatique de banques biologiques

Ce logiciel a été développé (ou est en cours de développement) dans la communauté de l'Enseignement Supérieur et de la Recherche. Son état peut être variable (cf champs ci-dessous) donc sans garantie de bon fonctionnement.
  • Site web
  • Système : UNIX-like
  • Version actuelle : 1.2 - 23/07/2011
  • Licence(s) : CeCILL
  • Etat : validé (au sens PLUME), diffusé, stable
  • Support : maintenu, développement en cours
  • Concepteur(s) : Olivier Sallou ( Plate-forme GenOuest - INRIA) Romaric Sabas ( Plate-forme GenOuest - INRIA) David Allouche (Unité de Biométrie Intelligence Artificielle - INRA ) Christophe Caron (plate-forme MIGALE - INRA ) Olivier Filangi ( Plate-forme GenOuest - INRIA )
  • Contact concepteur(s) : support@genouest.org
  • Laboratoire(s), service(s)... : GenOuest, INRIA Rennes, IRISA, MIG, UBIA

 

Une fiche logiciel décrit plus en détail ce développement, consultez la pour plus d’informations : BioMAJ
Fonctionnalités générales du logiciel

Le programme permet de se connecter à un site distant pour récupérer des banques biologiques (ensemble de fichiers plats) dans une arborescence. Régulièrement, le programme va inspecter ce site et détecter des changements en fonction d'un fichier de release ou en se basant sur les dates de modification des fichiers distants. Si une mise à jour est détectée, le logiciel rapatrie localement les données et exécute un workflow de transformation des données (si des transformations sont définies dans la configuration). Une fois ce workflow terminé, la nouvelle version est mise "en ligne" et l'ancienne version est éventuellement supprimée.

Le logiciel est développé en Java pour ce qui est du moteur de mise à jour. Les outils de workflow de transformations des banques biologiques sont gérés par des appels externes. Un certain nombre de scripts ont été fournis par l'équipe de développement sous la forme de scripts shell ou perl, d'autres scripts peuvent être soumis par la communauté via le site web de l'application.
L'outil ne tourne donc pour l'instant que sous Linux (ou Unix).

Il n'y a pas de contraintes de langages pour le développement de scripts, le logiciel met à jour un ensemble de variable d'environnement pour le script externe (nom de la banque, version actuelle etc..) et récupère les flux de sorties standard. Le code de retour du programme informe le logiciel du bon déroulement du process. Ceci offre une grande flexibilité dans le développement de processus de transformation.

Différents protocoles de communications sont disponibles pour récupérer les banques de données distantes (http, scp, ftp, s3). Le logiciel parcours ensuite l'arborescence distante pour analyser les changements et mettre à jour la banque si nécessaire en local. Des expressions régulières permettent de sélectionner ou exclude des fichiers/répertoires.

Le logiciel marche en ligne de commande et peut exécuter plusieurs mises à jour en parallèle. Le système de workflow permet, en cas d'erreur sur l'un des process, de reprendre une mises à jour là où il s'est arrêté.

Une interface web, le biomaj-watcher, permet également d'administrer les banques (configuration, mise à jour,...) et d'exposer aux utilisateurs des informations sur les banques disponibles. Une interface REST permet également d'interroger le système pour connaitre l'état des banques, ou la liste des banques disponibles dans tel ou tel format.

Le logiciel gère également la notion de banques privées et de banques publiques, offrant une visibilité plus ou moins restreinte sur les banques gérées via l'interface web.

Des rapports détaillés sur les banques disponibles et leurs états sont accessibles en ligne de commande, ou bien dans l'interface web.

Le logiciel est également disponible dans la distribution Debian/Ubuntu.

Contexte d’utilisation du logiciel

Le logiciel permet à de nombreux laboratoires utilisant des banques biologiques (Genbank, Uniprot,...) disponibles sur le web, de récupérer ces banques (ou une partie) localement afin de les traiter. Ceci inclu des transformations pour traitement ultérieurs (indexation Blast par exemple), ou bien de remettre à jour leurs propres données en les croisant avec les sites "généralistes".
Prenons un exemple:
Un programme particulier effectue des recherches sur un génome et affiche ses résultats sur le web.
Avec BioMAJ, le génome sera automatiquement mis à jour sur une base régulière (tous les mois par exemple), et un post-process défini dans le workflow de mise à jour exécutera ce programme pour analyser à nouveau les génomes, et donc afficher en permanence sur le web des données à jour.

Publications liées au logiciel

BioMAJ: A flexible framework for databanks synchronization and processing: http://bioinformatics.oxfordjournals.org/cgi/content/abstract/btn325?

Fiche logiciel validé
  • Création ou MAJ importante : 07/02/12
  • Correction mineure : 07/02/12
Mots-clés
Pour aller plus loin

Capsis : simulation de la croissance et de la dynamique des peuplements forestiers

Description
Fonctionnalités générales

Capsis est une plateforme de simulation de la croissance d'arbres en peuplements avec élaboration d'itinéraires sylvicoles. Ce logiciel traite de la croissance des arbres d'un point de vue forestier.

Il est principalement destiné à faciliter les choix en matière de gestion des peuplements forestiers mais constitue aussi un instrument précieux pour la recherche et l'enseignement.

Cet outil permet de simuler et comparer des scénarios sylvicoles (étapes de croissance ou éclaircie) définis par l'utilisateur : densité initiale, fertilité stationnelle, type et nature des interventions, etc…

Autres fonctionnalités
  • Support de différents type de modèles : niveau peuplement, niveau individus, avec/sans spatilisation etc...
  • Éditeur de scénarios sylvicoles avec différentes évolutions et interventions
  • Comparaison des résultats scénarios et sortie graphique
  • Visualisation 2D/3D des peuplements
  • Mode script et simulation en batch pour faire des analyses
Interopérabilité

Les formats d'entrée et de sortie sont définis par modèle. L'export de données vers des logiciels d'analyse de données (ex R) est possible.

Contexte d'utilisation dans mon laboratoire/service

La communauté Capsis est constituée par :

  • les modélisateurs qui intègrent leurs modèles forestiers au sein de la plateforme Capsis
  • les utilisateurs de modèles qui réalisent des simulations à partir de leur propre jeu de données
Limitations, difficultés, fonctionnalités importantes non couvertes

L'utilisation d'un modèle ne nécéssite pas de compétences particulières. Par contre l'ajout d'un modèle dans capsis nécéssite des notions de programmations Java. L'équipe capsis fournit le support nécéssaire à l'ajout de nouveaux modèles.

Environnement du logiciel
Plates-formes

Plateformes compatibles java 1.6

Environnement de développement
Type de structure associée au développement

Laboratoire de recherche : AMAP

Références d'utilisateurs institutionnels

INRA, CEMAGREF, CIRAD, ...

Environnement utilisateur
Liste de diffusion ou de discussion, support et forums
Documentation utilisateur

voir la documentation d'installation, la FAQ, des tutoriaux... : http://capsis.cirad.fr/capsis/documentation

Contributions
Fiche logiciel validé
  • Création ou MAJ importante : 27/02/12
  • Correction mineure : 21/05/19
Mots-clés
Pour aller plus loin
  • Fiches logiciel PLUME connexes : Cmake

ParadisEO : plateforme de développement de métaheuristiques hybrides parallèles sur grilles de calcul

Description
Fonctionnalités générales

ParadisEO est une plateforme logicielle libre, développée en langage C++, orientée-objet, portable (Unix, Windows, MacOS). Elle permet un développement flexible et réutilisable de métaheuristiques (méthodes d'optimisation approchées) et leur déploiement sur des grilles de calcul. Elle est basée sur la librairie EO (Evolving Objects), une plateforme libre, orientée-objet à base de templates et dédiée au calcul évolutionnaire.

ParadisEO se compose de quatre modules. Chaque module fournit des fonctionnalités spécifiques :

  • ParadisEO-EO fournit les classes permettant le développement de métaheuristiques à base de population de solutions telles que les algorithmes évolutionnaires et les algorithmes d'optimisation par essaim de particules (particle swarm optimization);
  • ParadisEO-MO, depuis la version 1.3, fournit en plus les classes pour le développement de méthodes de recherche locale (recuit simulé, recherche taboo, recherche locale itérative...) des outils pour l'analyse de paysage ;
  • ParadisEO-MOEO est le module pour la résolution de problèmes d'optimisation combinatoires multi-objectifs ;
  • ParadisEO-PEO permet de développer des métaheuristiques parallèles et distribuées. Ce module fournit des classes permettant, entre autres, l'évaluation parallèle des individus, la transformation (croisement, mutation) parallèle des individus et l'évaluation parallèle d'un individu dans le cas où la fonction d'évaluation est une fonction complexe, des recherches locales parallèles.

ParadisEO-GPU est quant à elle une version de ParadisEO qui permet l'exécution sur un processeur graphique (GPU: Graphics Processing Unit).

Autres fonctionnalités

ParadisEO permet également la coopération et l'hybridation de différentes métaheuristiques. Différents schémas d'hybridation entre métaheuristiques sont possibles. Il est possible, à titre d'exemple, d'hybrider un algorithme évolutionaire et une méthode de recherche locale ou de remplacer un opérateur génétique par une méthode de recherche locale.

Interopérabilité

L'architecture logicielle de ParadisEO est conçue en utilisant des design patterns permettant une grande interopérabilité avec d'autres logiciels et bibliothèques. Cela permet également une forte réutilisation du code à l'intérieur même de ParadisEO. De plus, une assistance par des ingénieurs de l'équipe de développement est proposée.

Contexte d'utilisation dans mon laboratoire/service

Ce logiciel est utilisé comme outil de recherche en optimisation, mais aussi sur des problématiques de HPC.

De grandes entreprises comme France Telecom l'utilisent dans un cadre de R&D.

Le pôle Informatique Scientifique de l'IRD l'a utilisé dans le
cadre d'un paramétrage d'un modèle d'océanographie. L'expérience a eu lieu en mode "grid" sur trois sites distants sur 200 cœurs de calcul.

Environnement du logiciel
Plates-formes

Unix-like, Windows et MacOS X.

Logiciels connexes
Autres logiciels aux fonctionnalités équivalentes
  • Open Metaheuristic (cette bibliothèque ne possède pas la fonctionnalité calcul parallèle)
Environnement de développement
Type de structure associée au développement

Ce logiciel a été développé par l'équipe DOLPHIN au sein de l'INRIA Lille - Grand Nord.

Eléments de pérennité

Ce logiciel est développé par deux ingénieurs à plein temps et par de nombreux thésards depuis neuf ans.

Références d'utilisateurs institutionnels
Environnement utilisateur
Liste de diffusion ou de discussion, support et forums
  • Liste d'aide : paradiseo-help [at] lists [dot] gforge [dot] inria [dot] fr
  • Communauté
Documentation utilisateur
Contributions

Un système de contribution a été mis en place.

Fiche dév Ens Sup - Recherche
  • Création ou MAJ importante : 29/04/10
  • Correction mineure : 04/11/11
  • Auteur de la fiche : Julie Josse (Laboratoire de mathématiques appliquées Rennes Agrocampus Ouest)
  • Responsable thématique : Christelle Dantec (CRBM)
Mots-clés

FactoMineR : package du logiciel R dédié à l'analyse de données

Ce logiciel a été développé (ou est en cours de développement) dans la communauté de l'Enseignement Supérieur et de la Recherche. Son état peut être variable (cf champs ci-dessous) donc sans garantie de bon fonctionnement.
  • Site web
  • Système : UNIX-like, Windows
  • Licence(s) : GPL
  • Etat : validé (au sens PLUME), diffusé, stable
  • Support : maintenu, développement en cours
  • Concepteur(s) : François Husson, Lê Sebastien, Julie Josse
  • Contact concepteur(s) : husson@agrocampus-ouest.fr
  • Laboratoire(s), service(s)... : Labo Maths Applis Rennes

 

Une fiche logiciel décrit plus en détail ce développement, consultez la pour plus d’informations : FactoMineR
Fonctionnalités générales du logiciel

FactoMineR est un package (ensemble de fonctions) du logiciel libre R dédié à l'analyse exploratoire de données. Il permet de réaliser des analyses factorielles classiques comme l'Analyse en Composantes Principales, l'Analyse des Correspondances, et l'Analyse des Correspondances Multiples et des analyses dédiées à des structures de données particulières comme l'Analyse Factorielle Multiple, l'Analyse Factorielle Multiple Hierarchique...
Il permet aussi de réaliser des enchainements analyse factorielle et classification.
Les analyses peuvent être réalisées à l'aide de ligne de code ou bien d'un menu déroulant.

Contexte d’utilisation du logiciel

Enseignement, Recherche

Publications liées au logiciel

FactoMineR: An R Package for Multivariate Analysis
http://www.jstatsoft.org/v25

Syndiquer le contenu