résumé

Résumé, fiche descriptive

Référentiel Général d'Accessibilité pour les Administrations (RGAA)

Fiche ressource Article, événement, site web...
  • Création ou MAJ importante : 21/10/10
  • Correction mineure : 25/11/10
Mots-clés

Référentiel Général d'Accessibilité pour les Administrations (RGAA)

Les administrations accessibles à tous !

Élaboration d'un référentiel français

Le développement des services publics numériques accessibles à distance (web, téléphonie, télévisuel) a amené le législateur à créer un texte de loi pour l'égalité des droits et des chances, la participation et la citoyenneté des personnes handicapées du 11 février 2005, article 47.
Cette loi, oblige les administrations françaises à se référer au Référentiel Général d’Accessibilité des Administrations pour développer leurs services en ligne.
La Direction Générale pour la Modernité de l'État (DGME) et la Délégation Interministérielle aux Personnes Handicapées (DIPH) se sont chargées d'élaborer ce référentiel en s'appuyant sur la directive WCAG 2.0, selon les niveaux A et AA émise par le W3C/WAI et dans le respect du projet "Initiative européenne i2010 sur l'insertion numérique.

Le RGAA version V2.2 du 23/10/09 se structure selon 5 documents :

  1. Présentation des règles de mise en œuvre.
  2. Guide d'accompagnement.
  3. Critères de succès. Les contenus doivent être : perceptibles, utilisables, compréhensibles, robustes (cf. Annexe 1).
  4. Tests de conformité : 187 tests portant sur la structure de la page Web (cf. Annexe 2).
  5. Grilles de correspondance entre les tests de succès et les tests de conformité (cf. Annexe 3).

Ces documents s'adressent aux maîtres d'ouvrage (chefs de projet, développeurs...) des autorités administratives.

Échéances d'application

A partir de la date de publication du décret 14 mai 2009, la loi impose un échéancier de mise en application de l'accessibilité des services pour tous :

  1. 2 ans pour les services de communication publique en ligne de l'État et établissements publics,
  2. 3 ans pour les services de communication publique en ligne des collectivités territoriales et des établissements publics qui en dépendent.

Fiches Plume connexes

  • Web Accessibility Initiative (WAI),

   - Un groupe d'experts travaille à l'élaboration d'un ensemble de recommandations destiné à faciliter l’accès aux services Web pour tous, en savoir plus...

  • HTML Validator : extension Firefox et Seamonkey,

   - Comment valider le code HTML d'une page Web, en savoir plus...

  • Les services de validation (Web) offerts par le W3C,

   - Les outils de validation disponibles en ligne, en savoir plus...

  • NAT Braille : transcription/détranscription en Braille.

   - Comment convertir plusieurs formats de fichiers en braille, en savoir plus...

Format SVG (Scalable Vector Graphics)

Fiche ressource Article, événement, site web...
  • Création ou MAJ importante : 21/10/10
  • Correction mineure : 05/11/10
Mots-clés

Format SVG (Scalable Vector Graphics)

Présentation

Comment illustrer une page Web sans contrainte de dimensions et de poids

Conçu par le World Wide Web Consortium (W3C) et basé sur le langage XML, le langage Scalable Vector Graphics (SVG version 1.1) permet de décrire des images vectorielles statiques, des formes et du texte. La description des polygones de l'image est donnée par des coordonnées polaires de points et des attributs CSS précisent le style de leur forme (couleur, transparence...). Contrairement à une image Bitmap, les dimensions d'une image vectorielle n'impactent pas le poids du fichier (.svg). Une image vectorielle peut s'agrandir à l'infini sans risque de pixelisation.

  1. Nom complet : Scalable Vector Graphics,
  2. Acronyme : SVG.

Extension par convention

Les fichiers SVG s'enregistrent avec l'extension .svg.

Versions

  1. Version actuelle : SVG 1.0, validée en juin 2006,
  2. Version en attente de validation : SVG 1.1 de juin 2010.

Documents de standardisation

  1. Directive SVG émise par le World Wide Web Consortium (W3C).

Avantages

  1. SVG est un format ouvert développé et maintenu par le groupe de travail SVG du W3C.
  2. De nombreux logiciels de PAO utilisent le langage SVG pour produire des images natives en 2D (.svg). Avec ce format, les graphistes disposent de possibilités de création illimitées.
  3. Les versions des navigateurs lisant le SVG sont : Mozilla Firefox 3.6.10, Chrome 6.0, Opéra 8.5, Internet Explorer 9 (version Bêta).

Inconvénients

  1. Initialement, pour visionner les images vectorielles (.svg), l'interface de visualisation (navigateur, écran de téléphone portable, PDA...) devait intégrer un viewer SVG. Ce plug-in n'était pas systématiquement installé par l'éditeur. Les versions récentes des navigateurs interprètent en natif le format SVG,
  2. Une page Web intégrant du SVG doit être enregistrée au format XML. Tous les navigateurs ne lisent pas encore le format XML. La récente révision de la directive du W3C/SVG (juin 2010) devrait mobiliser les concepteurs des navigateurs.

Utilisations recommandées

Le format SVG est adapté pour représenter des logos, icônes, tableaux, graphiques, cartographies mais inadapté pour les photos (jpg).
Par ailleurs, une animation d'images vectorielles s'obtient en utilisant du JavaScript ou du Java.

Logiciels de traitement

Logiciels libres

  1. Inkscape ; logiciel de graphisme vectoriel générant des fichiers SVG, (voir fiche Plume),
  2. Dia ; logiciel de dessin vectoriel (voir fiche Plume),
  3. Qwt ; bibliothèque de Widgets créant des objets SVG (voir fiche Plume),
  4. Qt ; bibliothèque multi plateformes permettant de créer des interfaces graphiques (voir fiche Plume),
  5. Amaya ; éditeur WYSIWYG (Html et SVG) et navigateur Web (voir fiche Plume).

Logiciels sous licences propriétaires

  1. Adobe Creative Suite ; ensemble de logiciels de PAO/Web exploitant les fichiers (.svg).

Autres formats

Formats connexes

Le format SVG s'appuie sur le format générique XML.

Formats concurrents

  1. Graphic Interface Format (GIF) : Format fermé d'images matricielles pour le Web,
  2. Portable Network Graphics (PNG) : Format ouvert d'images matricielles pour le Web plus récent que le GIF, le PNG gère la transparence,
  3. Flash développé par Adobe concurrence et/ou exploite les fichiers (.svg) dans le but de créer des animations sophistiquées en utilisant le langage ActionScript enregistrées au format propriétaire (flv).

URL pour plus d'informations

  1. W3C - L'actualité autour du SVG,
  2. Mozilla - Developper center, informations, démonstrations et outils pour développer du SVG,
  3. Le Mag IT - Site sur l'actualité de l'informatique, article sur l'évolution du SVG.

Format FITS : Flexible Image Transport System (astronomie)

Fiche ressource Article, événement, site web...
  • Création ou MAJ importante : 18/10/10
  • Correction mineure : 06/11/12
Mots-clés

Format FITS : Flexible Image Transport System (astronomie)

  • http://fits.gsfc.nasa.gov/
  • Type de ressource : résumé
  • Date de publication du document ou de l'événement : 1990
  • Auteur(s) ou responsable(s) : IAU (International Astronomical Union)

Acronyme :

FITS

Nom complet :

Flexible Image Transport System

Description courte :

Le format FITS, proposé à l'origine par la NASA et défini par l'IAU (International Astronomical Union), est un format dédié au stockage et à la manipulation de données scientifiques. C'est le format de données le plus couramment utilisé en astronomie mais aussi en physique des hautes énergies. Un fichier FITS est en général composé d'un en-tête ASCII lisible contenant l'ensemble des métadonnées associées à l'image et de données sous formes binaires contenant les mesures d'observation (courbes de lumières, cartes du ciel, image d'une galaxie, spectre, listes de photons,...). Le couple en-tête / données binaires est appelé HDU pour Header Data Unit.

Extension par convention :

.fits (parfois .fit ou .fts)

Documents de standardisation :

La première spécification (NOST 100-0.1) de ce format a été publiée en Décembre 1990.

La version la plus récente (IAUFWG 3.0), publiée en Juillet 2008, est décrite dans :
FITS Standard Document - Version 3.0 (July 2008) - PDF format

Avantages :

  • Standard, indépendant de la plate-forme utilisé
  • Format extensible

Inconvénients :

Le format autorisant les extensions personnalisées (propres mots-clés), un fichier FITS peut devenir illisible par certains logiciels car ne respectant plus strictement le standard. Ceci dit, dans la mesure ou le format définit des extensions communes et obligatoires à tout fichier FITS, les informations principales devraient être lisibles.

Utilisations recommandées :

Ce format est couramment employé en astronomie car il permet d'associer les informations d'observations (les mesures sous forme binaire) et les métadonnées associées sous forme ASCII (informations sur le satellite qui observe, données déjà connues sur la zone d'observation...). Ainsi, lorsque l'on récupère un fichier FITS de provenance inconnue, on peut savoir, grâce à ses métadonnées, de quelle observation il s'agit.

Logiciels de traitement :

De nombreux outils de manipulation et logiciels gratuits sont proposés par la NASA sur FITS resources.

Une librairie indispensable qui permet de lire et écrire des fichiers FITS à partir de programmes C ou Fortran : CFITSIO - A FITS File Subroutine Library.
Cette dernière a aussi été portée pour les langages C++ et Perl

Les fichiers FITS peuvent être exploités avec des logiciels de traitement d'image comme ESO-MIDAS ou SAOImage ds9.

Un excellent outil pour manipuler ces fichiers est TOPCAT. Il permet notamment d'exporter un fichier sous d'autres formats (TEXT, ASCII, CVS, HTML, VOTable, LaTeX,...) et comporte de nombreux outils d'édition, visualisation, recherche, concaténation, calcul d'histogramme,...et des outils de VO (Observatoire Virtuel) comme le "Cone Search" ou la possibilité de faire des requêtes sur des catalogues externes.

Structure du fichier FITS :

Un fichier de données au format FITS est constitué d'une ou plusieurs HDUs, chacune de ces HDU contenant deux parties : un en-tête lisible ASCII et un bloc de données binaires.
L'en-tête comporte une série de mots clés (header keywords) qui décrivent les données binaires de la HDU.

Le premier en-tête du fichier est appelé l'en-tête primaire (primary header). Les HDUs qui suivent la HDU primaire sont appelées extensions.
La HDU primaire doit forcément contenir un en-tête et peut contenir ou non des données binaires. Les extensions peuvent contenir indifféremment différents types de données tels que en-tête ASCII, tables binaires, images,...

L'en-tête est constitué de paires "mot clé / valeur" de longueur fixe 80 caractères. Le mot clé est généralement en majuscule. Certains mots clés de l'en-tête primaire sont obligatoires (appelés mandatory keywords).
Ces mandatory keywords sont : SIMPLE (T si le fichier est conforme au standard, F sinon), BITPIX (nombre de bits par pixel de données), NAXIS (dimension des données), NAXISn (nombre d'éléments dans la dimension n) et END (fin de l'en-tête).

A ces mots clés obligatoires, d'autres mots clés réservés (mais optionnels) peuvent être rajoutés comme DATE (date de création de la HDU), ORIGIN (Source de la création du fichier FITS), EXTEND (présence d'extensions ou non), DATE-OBS (date de l'observation), TELESCOP, INSTRUME, FILENAME, COMMENT,...

Exemple (extrait de l'en-tête primaire d'un fichier fits de l'instrument SECCHI/STEREO) :

SIMPLE  =                    T / Written by IDL:  Fri Sep  3 13:24:14 2010      
BITPIX  =                   32 / 32-bit twos complement binary integer          
NAXIS   =                    2 /                                                
NAXIS1  =                 1024 /                                                
NAXIS2  =                 1024 /
EXTEND  =                    T /                                                
DATE-OBS= '2010-09-01T23:29:57.153' /
...
ORIGIN  = 'NRL     '           /                                                
FILENAME= '20100901_232901_s4h1B.fts' /
DATE    = '2010-09-03T16:06:34.920' /                                           
INSTRUME= 'SECCHI  '           /
...
END

Enfin, de nouveaux mots clés peuvent être insérés dans l'en-tête (additional keywords). Ils doivent respecter le standard (longueur de la paire "mot clé / valeur" de 80 caractères) et ne pas rentrer en conflit avec les noms des mots clés obligatoires ou réservés.

Après le mot clé END, le HDU peut se poursuivre avec des données binaires.

Commentaires :

FITS est généralement classé dans la catégorie "Format d'image". Mais ce format n'est pas aussi limité que les autres formats d'images classiques (matrices de points en 2D ou 3D, la troisième dimension étant utilisé pour le codage des couleurs) dans la mesure où il peut être de dimension arbitraire.
Ainsi, un fichier FITS peut contenir plusieurs en-têtes différents associés à une même image. De même, un seul fichier peut contenir plusieurs images (par exemple, une image représentée sous plusieurs longueurs d'ondes différentes)

URL pour plus d'informations :

FITS Support Office

Pas de sécurité offensive sur PLUME

Fiche ressource Article, événement, site web...
  • Création ou MAJ importante : 27/07/10
  • Correction mineure : 27/07/10
Mots-clés

Pas de sécurité offensive sur PLUME

  • Type de ressource : résumé
  • Date de publication du document ou de l'événement : Juillet 2010
  • Auteur(s) ou responsable(s) :

    François Morris Responsable Thématique Sécurité dans PLUME

Conscient de ses responsabilités et soucieux de respecter la loi (notamment l'article 323-3-1 du code pénal), le projet PLUME se refuse à publier des fiches sur des outils destinés à exploiter des vulnérabilités ou à effectuer des intrusions sur des systèmes. Ces outils ont toute leur utilité lorsqu'il s'agit, avec toutes les précautions nécessaires, de faire des audits ou des tests d'intrusions mais ils peuvent aussi servir pour des actions illégales.
En matière de sécurité le projet PLUME accepte et encourage des fiches sur tous les sujets traitant de la défense.
Il est important de connaître ses propres vulnérabilités pour les corriger et les méthodes des attaquants pour s'en protéger. Aussi le projet PLUME ne s'interdit pas de publier des fiches sur des outils permettant de détecter des vulnérabilités ou sur des conférences, des sites traitant de sécurité informatique même s'ils abordent aussi des techniques d'attaques ou décrivent des exploits, tant que l'objectif reste la protection.

Le projet PLUME se limite à la sécurité défensive et exclut la sécurité offensive.

Format JSON : JavaScript Object Notation

Fiche ressource Article, événement, site web...
  • Création ou MAJ importante : 16/07/10
  • Correction mineure : 22/07/10
  • Fiches logiciel PLUME connexes : Firebug
Mots-clés

Format JSON : JavaScript Object Notation

JSON est l'acronyme de JavaScript Object Notation. C'est un format texte qui permet de représenter des données et de les échanger facilement à l'instar d'XML. JSON est un sous ensemble d'ECMAScript (JavaScript) et est décrit dans le RFC 4627. Ce sous ensemble de JavaScript permet de décrire le modèle objet de JavaScript. Deux types de structures sont disponibles :

  • Objet : une collection de paire nom/valeur, i.e un tableau associatif.
  • Tableau : une liste ordonnée de valeurs.

Les valeurs peuvent être des types suivants : booléen, chaîne de caractères, nombre, ou valeur nulle. (boolean, string, number, null), ou une des structures ci-dessus. La syntaxe est celle de JavaScript, simpliste. Voici par exemple la description d'un utilisateur avec une adresse et des numéros de téléphone :

{ 
"nom":"Bob",
"age":34,
"addresse": { "rue":"avenue Grande", "ville":"Rio", "code":86945},
"telephone":[ {"type":"maison", "numero" : 123456}, {"type":"portable", "numero": 654321} ]
}

L'équivalent en XML serait :

<utilisateur nom="Bob" age="34"> 
<adresse>
<rue>avenue Grande</rue>
<ville>Rio</ville>
<code>86945</code>
</adresse>
<telephones>
<telephone type="maison">123456</telephone>
<telephone type="portable">654321</telephone>
</telephones>
</utilisateur>

En comparaison, le format JSON ne fait pas de différence entre attribut et élément comme en XML. Il est donc moins sujet à variation, et est globalement plus concis et plus lisible. Les valeurs sont typées alors qu'en XML on ne dispose que de chaînes de caractères.

Au delà de la lisibilité, l'avantage majeur est de pouvoir facilement intégrer des objets JSON dans une application JavaScript. Par exemple si user désigne l'utilisateur représenté ci-dessus :

var bob = eval("(" + user + ")");

Les butineurs web récents comme Firefox 3.5 disposent d'un analyseur syntaxique JSON intégré qui permettent moins de dérive que l'évaluation brute par eval:

var bob = JSON.parse(user);

L'utilisation d'une bibliothèque JavaScript permettant d'enrober les différences de gestion entres les navigateurs est recommandée pour éviter des problèmes de portabilité.

Références :

  • RFC 4627 : D. Crockford, The application/json Media Type for JavaScript Object Notation (JSON), 2006

Format fasta : représentation de séquences nucléiques ou protéiques (biologie)

Fiche ressource Article, événement, site web...
  • Création ou MAJ importante : 09/07/10
  • Correction mineure : 09/10/13
Mots-clés

Format fasta : représentation de séquences nucléiques ou protéiques (biologie)

Version : pas de version

Extension : .fa, .fasta, .fsa

Type de document : Fichier texte tabulé

Document de standardisation :
Page descriptive sur le site de NCBI
Page descriptive sur le site de HUPO
Page descriptive sur le site de Wikipedia

Description courte :
Format qui permet de représenter un ou plusieurs séquences (nucléiques ou protéiques). Une ligne qui commence par le symbol '>' caractérise le début d'une nouvelle séquence. Le symbol '>' est suivi d'un identifiant de séquence et de commentaires éventuels. Les lignes suivantes constituent la séquence (jusqu'à ce qu'une nouvelle ligne commence par '>' ou la fin de fichier). Exemple :

>FBtr0302953 type=mRNA; loc=2R; name=CG42703-RA;  
TAACCCATAATGTCGAATATACTTGCTGCCAAACTCGACTGCCAATGCGC
CGGAAAAAACAGTCCCATGGATTCGGTGATAGTGCCGATTACCCAGGAAC

Avantages :

  • Est un des standards les plus utilisés en bioinformatique.
  • La plupart des logiciels reconnaissent ce format
  • Ce format peut contenir plus ou moins d'informations (en les ajoutant sur la ligne commencant par '>').

Inconvénients :
Format minimaliste (mais c'est également sa force!)

Logiciels de traitement les plus connus :

Format connexe :

Format CIF : Crystallographic Information File (cristallographie)

Fiche ressource Article, événement, site web...
  • Création ou MAJ importante : 07/06/10
  • Correction mineure : 08/11/10
Mots-clés

Format CIF : Crystallographic Information File (cristallographie)

Acronyme : CIF

Nom complet : Crystallographic Information File

Description courte : Fichier texte
Le format CIF a été défini par l'IUCr (Union Internationale des Cristallographes) pour échanger des informations entre les logiciels de cristallographie. C'est un fichier ascii qui est régi par une orthographe et une grammaire spécifiques.

Extension par convention : .cif parfois .acc (Acta Crystallographica C)

Document de standardisation :

La version 1.0 de la spécification CIF est décrite dans:
S. R. Hall, F. H. Allen and I. D. Brow
The crystallographic information file (CIF): a new standard archive file for crystallography
Acta Cryst. (1991). A47, 655-685
doi:10.1107/S010876739101067X

La revision 1.1, actuellement en vigueur, est maintenue par la COMCIF, la commission de l'IUCr pour la promotion et la maintenance du format CIF.

Avantages : C'est un standard ouvert, bien défini, extensible et largement répandu.

Inconvénients :

  • Beaucoup d'informations peuvent être décrites de différentes façons, limitant parfois la compatibilité entre les logiciels.
  • Beaucoup de fichiers corrompus (édités à la main et non re-validés)

Utilisations recommandées :

  • Archivage et publication des structures cristallographiques, après validation.
  • Vecteur d'informations cristallographiques au sein d'un pipeline de traitement d'information entre les logiciels de cristallographie (semblable à l'XML).

Logiciels de traitement les plus connus :

  • Edition : enCIFer (édité par le CCDC ) est un éditeur de texte avec validation syntaxique et grammaticale des fichiers CIF ainsi qu'un visionneur des structures 3D.

  • Visualisation des structures : Mercury (du CCDC), sans doute un des plus conviviaux.
  • Validation : Platon est le logiciel sur lequel s'appuie l'IUCr pour valider les fichiers CIF avec CheckCIF.
  • Création des structures : ShelX (affinement des structures aux moindres carrés), Fox (résolution des structures sur poudre), FullProf (affinement de Rietveld).

Tous ces logiciels sont libres, gratuits ou en licence académique et donc méritent la promotion par Plume.

Structure du fichier CIF

  • Grammaire

    La grammaire est celle du format STAR, un peu simplifiée: il s'agit d'un format texte en ASCII éditable à la main (avec un simple éditeur de texte) qui est composé soit de paires {clé, valeur}, soit d'une liste ordonnée de ces paires, appelées boucles (loop_).
    Toutes les clés commencent par "_" et peuvent contenir plusieurs underscores, les autres mots réservés sont "data_" (pour délimiter les blocs de données) et "loop_" pour définir les boucles.

    • Les boucles :
      Un seul niveau de boucle est autorisé. Elles débutent par la liste des clés puis continuent avec toutes les valeurs. Le nombre de valeurs doit donc être un multiple du nombre de clés de la boucle.

    • Les séparateurs :
      Les espaces, tabulations et retours à la ligne (\n et \r\n) sont des séparateurs de champs, il faut utiliser des guillemets ' ou " pour les valeurs si elles contiennent des espaces ou des tabulations. Des valeurs multi-lignes sont possibles entre deux ";" en début de ligne.

  • Orthographe du CIF :

    La liste des mots clés est validée par la COMCIF, ces mots-clés sont rangés dans des dictionnaires consultables en ligne, par exemple le dictionnaire général "core" (le plus important) ainsi que des dictionnaires spécialisés pour les macromolécules (mmCIF), pour les images (imgCIF ou CBF), la diffraction des poudres (PowderCif) ...

Alternatives OpenSource : référentiel d'équivalents Open Source à des logiciels propriétaires

Fiche ressource Article, événement, site web...
  • Création ou MAJ importante : 21/04/10
  • Correction mineure : 19/12/11
Mots-clés

Alternatives OpenSource : référentiel d'équivalents Open Source à des logiciels propriétaires

Ce site a pour objectif de proposer des alternatives à des logiciels commerciaux.

Par exemple:

Parmi les alternatives proposées, certaines ont fait l'objet de fiches PLUME. Ces informations sont proposées par grands thèmes, tels que :

  • communications,
  • développement,
  • internet et réseau.

Elles sont aussi proposées par familles d'outils : chat, voip, packet-sniffer, ......

Chaque outil est caractérisé par une liste de tags (comparables aux mots-clés de PLUME).

Les logiciels commerciaux présents sur osalt sont caractérisés par une virgule rouge, et les logiciels libres par une virgule verte.

Ce site est ouvert, dans le sens où une page spécifique Suggest Software permet de proposer des logiciels nouveaux, ou d'entrer une requête concernant une application non encore présente sur ce site.

Ce site peut être considéré comme une aide dans la recherche de solutions alternatives à des logiciels commerciaux. Les listes de solutions alternatives ne sont pas exhaustives, et ces solutions sont notées et annotées par des utilisateurs de osalt.

Protocole OAI-PMH

Fiche ressource Article, événement, site web...
  • Création ou MAJ importante : 19/04/10
  • Correction mineure : 12/08/13
Mots-clés

Protocole OAI-PMH

Le protocole OAI-PMH est utilisé au niveau mondial par les acteurs du monde des archives électroniques ouvertes pour échanger des métadonnées. Ce protocole permet à toute personne qui le souhaite de récupérer les métadonnées (titre, auteurs, résumé, mot-clés, url...) des documents de l'archive.

Dans le protocole, l'archive est nommée "fournisseur de données", et la personne ou le programme qui récupère les métadonnées est le "moissonneur" (voir Wikipedia).

Une requête basée sur une URL utilisant 7 "verbes" permet au moissonneur de récupérer et de tenir à jour un référentiel des métadonnées d'une archive. Les moissonneurs peuvent aussi récupérer les métadonnées provenant de plusieurs archives.

Les fournisseurs de données rendent leurs métadonnées disponibles au format Dublin Core (oai_dc), mais d'autres formats standards ou personnalisés sont possibles.

 

Le logiciel libre dans un laboratoire de recherche en chimie

Fiche ressource Article, événement, site web...
  • Création ou MAJ importante : 16/02/10
  • Correction mineure : 01/12/11
Mots-clés

Le logiciel libre dans un laboratoire de recherche en chimie

Cette fiche se veut non exhaustive et traite des possibilités d'utilisation et du retour d'expérience de l'utilisation de logiciels libres dans un laboratoire.

Son unique but est de donner quelques pistes pour le déploiement de ressources informatiques dans le monde de la recherche en chimie.

On peut distinguer 3 principaux domaines :

  • les applications purement scientifiques ;
  • les applications liés à la « gestion administrative scientifique » : référencement, édition de documents scientifiques, etc ;
  • la gestion et l'administration d'un réseau dans un laboratoire de recherche.

1. Les applications scientifiques

Elles sont liées au domaine de recherche et aux équipements utilisés. Pour un équipement "commercial" et dans le cadre d'une acquisition de données, l'application principale est généralement un logiciel dit « constructeur ». Cela peut également être un développement local mais il s'agit plus rarement d'un logiciel dit « libre » et le système d'exploitation est le plus souvent basé sur Windows. Par contre, pour la partie traitement, il existe toute une panoplie de logiciels libres à disposition des utilisateurs et qui sont spécifiques pour chaque discipline ou chaque traitement. Entre autres, on trouvera des "outils" Open Source dans le cadre de la modélisation moléculaire, de la simulation, de l'analyse, etc… (développements pour tous les systèmes d'exploitation). Il est difficile de tous les lister, tant les spécialités sont nombreuses.

Quelques sites web qui répertorient les logiciels libres en chimie (il y en a beaucoup d'autres....) :

Une piste de recherche : dans un navigateur, taper « logiciel libre » + domaine (par exemple « spectroscopie ») ou type de traitement .....

2. Les applications de gestion administrative scientifique

Mots clés : bureautique, communication internet, bibliographie, graphisme

Les "puristes" choisiront bien entendu des suites LaTEX et autres TEX pour éditer leurs documents scientifiques.

Les outils classiques de bureautique et d'accès à internet sont également très utilisés (Firefox, Thunderbird, OpenOffice, Gimp, PDFCreator, etc).

L'aspect "gestion bibliographique" a été très bien traité lors d'une journée "Plume" :

http://www.projet-plume.org/fr/ressource/journee-plume-biblio-2009

Concernant la partie graphique, il existe une multitude d'outils de dessin de molécules dans tous leurs états.

Remarque : Pour ce qui est de notre propre expérience, le couple "Windows/Office" est préféré au package "Linux/OpenOffice" du fait des habitudes des chercheurs et d'importants échanges de documents avec l'extérieur, notamment le monde industriel (problèmes de compatibilité). Par contre, on trouvera du "Libre" dans tous les autres domaines.

3. Logiciels Open Source utilisés dans le cadre de la gestion et de l'administration réseau (cette rubrique n'est pas propre à un laboratoire de recherche en chimie)

L'utilisation des logiciels Open Source offre des services très intéressants dans la gestion et l'administration d'un réseau de laboratoire, notamment dans le cas d'une petite entité (une cinquantaine de personnes). Ces services ne sont pas spécifiques au domaine "chimie" et sont utilisés par beaucoup d'Administrateurs Systèmes et Réseaux.

Entre autres, on peut citer :

  • OCS Inventory NG : solution puissante d’inventaire du parc informatique via notamment la récuperation automatique de la configuration matérielle et logicielle des ordinateurs
  • GLPI : helpdesk, système de suivi des demandes, couplé avec OCS Inventory NG il facilite la gestion de parc
  • Syslog NG : gestion de traces (variante php-syslog-ng : interface web basée sur un script php qui permet de lire les logs générés par un serveur local ou une machine distante)
  • CUPS : serveurs d'impression
  • Apache : serveur http
  • Php : langage informatique orienté programmation Web
  • MySql : serveur de bases de données relationnelles

-----------------------------------------------------------------------------------------------------------

Remarque 1 : Dans le cadre de la gestion et de l'administration d'une Unité de Recherche, il y a lieu de déployer les applications spécifiques à cet effet (par exemple catalogue de la DSI pour les unités CNRS).

Remarque 2 : Un aspect particulier, le développement d'applications dans un laboratoire de recherche(cf. http://www.projet-plume.org/relier - http://www.projet-plume.org/fr/breve/plume-juin-juillet-2009)

-----------------------------------------------------------------------------------------------------------

Avez-vous un complément d'informations ou des références intéressantes à
nous signaler?

Merci de les indiquer dans un commentaire au bas de cette page ou d'écrire à plume [at] services [dot] cnrs [dot] fr (plume).

Syndiquer le contenu